Conservation Genet Resour DOI 10.1007/s12686-014-0400-8 MICROSATELLITE LETTERS Development of nuclear and mitochondrial microsatellite markers for the relictual conifer genus Athrotaxis (Cupressaceae) Shota Sakaguchi • James R. P. Worth Gregory J. Jordan • Philip Thomas • Motomi Ito • Received: 11 November 2014 / Accepted: 3 December 2014 Ó Springer Science+Business Media Dordrecht 2014 Abstract Athrotaxis D. Don (Cupressaceae) is a relictual conifer genus and is comprised of two or three ecologically divergent species endemic to Tasmania. Utilizing RNA-seq data obtained by next generation sequencing techniques, 16 polymorphic EST-SSR (simple sequence repeats in expressed sequence tags) markers with 2–15 alleles in nuclear and mitochondria genomes were developed and characterized. These markers will be used to investigate the speciation and hybridisation processes in the genus, the species’ range-wide genetic structure and diversity and the importance of clonality in maintaining current populations. Electronic supplementary material The online version of this article (doi:10.1007/s12686-014-0400-8) contains supplementary material, which is available to authorized users. S. Sakaguchi (&)
M. Ito Laboratory of Plant Evolution and Biodiversity, Department of General Systems Studies, Graduate School of Arts and Sciences, The University of Tokyo, Tokyo, Japan e-mail: sakaguci54@gmail.com M. Ito e-mail: cmito@mail.ecc.u-tokyo.ac.jp J. R. P. Worth
G. J. Jordan School of Biological Sciences, University of Tasmania, Private Bag 55, Hobart, TAS 7001, Australia e-mail: tmesipteris@gmail.com G. J. Jordan e-mail: Greg.Jordan@utas.edu.au P. Thomas Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 5LR, UK e-mail: P.Thomas@rbge.ac.uk Keywords Athrotaxis
Cupressaseae
Microsatellites
Next generation sequencing
Tasmanian endemic Athrotaxis D. Don (2n = 22) is a conifer genus comprised of two or three evergreen tree species endemic to Tasmania. Athrotaxis cupressoides D. Don is a species with small scale-like leaves appressed to the stem and female cones with short bract scales, whereas Athrotaxis selaginoides D. Don has spreading, keel shaped leaves up to 12 mm long and elongated bract scales. These two species have broadly similar geographic distributions, but A. cupressoides is more common in open high altitude vegetation whereas A. selaginoides is most abundant as an emergent tree in lowland and montane cool temperate rainforest. A third taxon, known as Athrotaxis laxifolia Hook. or A. X laxifolia Hook. (Hill 1998) is sometimes considered to be a hybrid because of its intermediate morphology, the fact that it is always found with one or other parent species and because seed grown from one individual segregate in the manner expected of an F1 hybrid (Jordan et al. 2004). This study will develop nuclear and mitochondrial SSR markers that can be used in all three members of the genus. These markers will be used to address two principle aims. Firstly, we aim to investigate the evolutionary relationship of A. cupressoides and A. selaginoide, and the existence of a putative hybrid, A. laxifolia. Secondly, we aim to understand the range-wide genetic diversity of all species and ascertain the level of gene-flow between populations that are often significantly isolated on mountain summits. This is important because the IUCN recognises all members of the genus as threatened. Understanding the distribution of genetic variation in the species will help to prioritize conservation efforts because 123 123 Table 1 Nuclear and mitochondrial EST-SSR markers for Athrotaxis D. Don Locus Primer sequence (50 –30 )a Repeat motif Allele size (bp) BLASTX top hit descriptionb E-value Accession no.c Ath_10091 F: CTATAGGGCACGCGTGGTTCGTCAGGGATTGGAGTGC (AATGGG)4 226/238 (fixed heterozygote) – – XIRK-10091 (CTT)6 279–288 Hypothetical protein 6.00E-09 XIRK-10767 (AGC)4 370–427 – – XIRK-10577 F: TGTGGAATTGTGAGCGGTCTGGGCATCATGGGTTGG R: GTTTCTTCAGGAAGCCTTGTTGCAGG (AGG)8 375–417 – – XIRK-10680 F: TGTGGAATTGTGAGCGGATGGAACCTAGCTGCCTCG (AAC)8 412–451 Hypothetical protein 6.00E-178 XIRK-10333 (AAGTGG)4 399–417 Hypothetical protein 1.00E-90 XIRK-10364 (AACCCT)4 415–421 E3 ubiquitin-protein ligase RING1-like 1.00E-11 XIRK-10673 (AAGGAG)4 457–469 Hypothetical protein 2.00E-84 XIRK-10514 (CTTT)23 249–289 Mitochondrial atp6 mRNA for ATPase subunit 6 2.00E-14 XIRK-0007753 (AT)11 218–238 – – XIRK-0007271 (AG)10 289–301 – – XIRK-0107243 (GCT)9 326–335 – – XIRK-0012547 (CGG)9 378–387 Hypothetical protein 4.00E-110 XIRK-0004711 – XIRK-0006568 R: GTTTCTTAGGTCGAGCAAAGACCCAG Ath_10767 F: CACGACGTTGTAAAACGACACACCCAAGTCCCTCAAGC R: GTTTCTTTTGACTCTCAGTGGTGCCC Ath_10577 F: CTATAGGGCACGCGTGGTTCAGCAGTCGAGCCTACAG R: GTTTCTTGAGCTGGGAGAGAAGTTGC Ath_10680 Ath_10333 R: GTTTCTTTGGCAATGTCTTGAACCGC Ath_10364 F: TGTGGAATTGTGAGCGGGCCCATGTCCATGCATCAG R: GTTTCTTCCGTTGTTACCATCTGGCG Ath_10673 F: CTATAGGGCACGCGTGGTTGGATGGTGGGCAAGACC R: GTTTCTTGCGGCAGGGTCATTGTTAG Ath_10514 F: CACGACGTTGTAAAACGACCCTCGGCCATGACTACCAG R: GTTTCTTGACTGAGACTAGCCCTGCC Ath_0007753d F: CACGACGTTGTAAAACGACCCACCCAGCTATATCTTCCCG R: GTTTCTTTGACCAGCCATCATATTAGCG Ath_0007271 F: TGTGGAATTGTGAGCGGACCATGTGAATGAAAGCCAG R: GTTTCTTGTTTCATGCTGGTCGCAGG Ath_0107243 F: CTATAGGGCACGCGTGGTCAGCTCACGAAACGCCAAC R: GTTTCTTTCGCGTAGAAGGCTAGCTG Ath_0012547 F: CTATAGGGCACGCGTGGTTCGCCTGAACCTGAGATCG R: GTTTCTTCCGGGAAGCCAACAATGAAG Ath_0004711 F: CTATAGGGCACGCGTGGTGCACTCCACGATTTCCAGC – R: GTTTCTTCCCAAACCTGCCGATGTTC Ath_0006568 F: TGTGGAATTGTGAGCGGGCTTACAACCGCCCAGAAG – (AAT)9 407–410 – – Ath_0010749 F: TGTGGAATTGTGAGCGGAGGTCGTGAGGACGAATCC (AAG)9 410–419 – – XIRK-0010749 Ath_0005605 R:GTTTCTTGATTGCACGGCCATAACCC F: TGTGGAATTGTGAGCGGACACCTGCTCCAGCGTTC (CT)8 274–280 – – – XIRK-0005605 R: GTTTCTTAGCCACAAGCATTTGCAGG Conservation Genet Resour R: GTTTCTTCAGATGGGCCAGAGGGTTG d Putative functional annotation by the NCBI nr database search Accession number in Plant OneKP Project database (https://sites.google.com/a/ualberta.ca/onekp/home) A locus located in mitochondria genome c b Forward and reverse primer sequence with tag sequence. Either of the M13 sequence (50 –CACGACGTTGTAAAACGAC-30 /50 -TGTGGAATTGTGAGCGG-30 /50 -CTATAGGGCACGCGTGGT-30 ) was added to forward primer, and a pig-tail sequence (50 –GTTTCTT-30 ) was tagged with reverse primer Annealing temperature in PCR reaction is 60 °C for all loci a XIRK-0110469 – – – 379–389 (AC)8 F: CTATAGGGCACGCGTGGTATGCCTACGGGAGAAGCTG Ath_0110469 R: GTTTCTTGCACGTGAAGATTGCAGAGG Primer sequence (50 –30 )a Locus Table 1 continued Repeat motif Allele size (bp) BLASTX top hit descriptionb E-value Accession no.c Conservation Genet Resour the species is highly vulnerable to fire with little to no subsequent recovery. RNA-seq data of A. cupressoides D. Don was obtained from the Plant OneKP Project repository. We screened the sequences including microsatellite regions for C6 dinucleotide repeats and C4 tri- to hexa-nucleotide repeats and designed primers using MSATCOMMANDER (Faircloth 2008). A total of 1,563 primers pairs bordering microsatellites were designed and 90 pairs were selected for PCR amplification trials using eight individuals (‘‘Appendix’’). PCR reaction was carried out following the standard protocol of the Qiagen Multiplex PCR Kit (Qiagen, Hilden, Germany), in a final volume of 10 lL, which contained approximately 5 ng of DNA, 5 lL of 29 Multiplex PCR Master Mix, and 0.01 lM of forward primer, 0.2 lM of reverse primer, and 0.1 lM of fluorescently labeled M13 primer. The PCR thermal profile involved denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 60 °C for 3 min, 68 °C for 1 min, and a final 20 min extension step at 68 °C. PCR product lengths were assessed using an auto sequencer (GenomeLabTM GeXP, Beckman Coulter, CA, USA). For the 43 primer pairs with clear microsatellite peaks, the extracted DNA of each 24 individuals of A. cupressoides and A. selaginoides, and eight individuals of A. laxifolia was used to evaluate allelic polymorphism. To characterize each marker, summary statistics below were calculated using FSTAT 2.9.3 (Goudet 1995): number of alleles per locus (A), allelic richness (Ar), expected heterozygosity (He), and observed heterozygosity (Ho). The significance of Hardy–Weinberg equilibrium and genotypic equilibrium were tested by 1,000 randomizations, using FSTAT 2.9.3. Seventeen loci were polymorphic in the initial PCR trials (Table 1). A locus (Ath_10091) was excluded from subsequent marker characterization, because all the individuals were fixed to a heterozygote genotype. The other loci showed polymorphism across three taxa, ranging from 2 to 15 alleles, while He and Ho ranged from 0.035 to 0.837 and 0 to 0.607, respectively (Table 2). Genetic diversity was highest in the putative hybrid of A. laxifolia (Ar = 3.1, He = 0.468), followed by its parental species of A. cupressoides (Ar = 2.5, He = 0.342) and A. selaginoides (Ar = 1.5, He = 0.149). No significant departures from Hardy–Weinberg equilibrium were detected in each taxon, except for a mitochondrial marker (Ath_0007753). No evidence for genotypic equilibrium for any pair of loci was detected (P [ 0.05). These EST-SSR markers will be useful to investigate the evolutionary dynamics including the role of interspecific hybridization and conservation genetics of this relictual genus. Especially, the mitochondrial SSR marker, which is known to be paternally inherited in Cupressaceae conifers (e.g., Neale et al. 1989), will be useful in examining if 123 Conservation Genet Resour Table 2 Characteristics of the 16 polymorphic EST-SSR markers for Athrotaxis D. Don Locus A. cupressoides (n = 24) A. laxifolia (n = 8) A Ar He Ho A Ar He Ho Ath_10333 10 8 0.864 0.75 7 7 0.703 1 Ath_10364 1 1 0 0 2 2 0.218 0.25 Ath_10514 1 1 0 0 2 2 0.218 0 Ath_10577 5 5 0.760 0.666 7 7 0.804 1 Ath_10673 2 2 0.486 0.583 2 2 0.304 0.375 Ath_10680 3 2 0.254 0.291 3 3 0.226 0.25 Ath_10767 1 1 0 0 2 2 0.5 1 Ath_0004711 5 5 0.696 0.5 4 4 0.632 1 Ath_0005605 1 1 0 0 3 3 0.539 0.75 Ath_0006568 1 1 0 0 2 2 0.492 0.875 Ath_0007271 Ath_0007753a 2 5 2 4 0.429 0.645 0.541 0* 3 1 3 1 0.539 0 0.875 0 Ath_0010749 1 1 0 0 2 2 0.5 1 Ath_0012547 2 2 0.468 0.666 3 3 0.617 1 Ath_0107243 3 3 0.632 0.5 4 4 0.648 1 Ath_0110469 2 2 0.249 0.125 3 3 0.554 1 Average 2.8 2.5 0.342 0.289 3.1 3.1 0.468 0.710 Locus A. selaginoides (n = 24) Total (n = 56) A Ar He Ho A Ar He Ho Vouchers representing each population are deposited at the Kyoto University Herbarium [KYO; accession numbers KYO 00019889 (A. cupressoides 41°530 49.000 S, 146°360 59.700 E), KYO 00019890 (A. laxifolia 42°400 07.500 S, 146°330 37.000 E) and KYO 00019884 (A. selaginoides 41°470 04.600 S, 145°350 37.400 E)] Ath_10333 1 1 0 0 15 7 0.721 0.464* Ath_10364 1 1 0 0 2 1 0.035 0.036 Ath_10514 Ath_10577 1 3 1 3 0 0.525 0 0.416 2 10 1 7 0.035 0.837 0* 0.607* Ath_10673 1 1 0 0 2 2 0.4 0.303* Ath_10680 3 3 0.517 0.083 5 3 0.417 0.196* Ath_10767 1 1 0 0 2 2 0.5 0.142* Ath_0004711 1 1 0 0 5 4 0.65 0.357* Ath_0005605 2 2 0.413 0.5 3 3 0.599 0.321* A number of alleles per locus, Ar allelic richness, He expected heterozygosity, Ho observed heterozygosity, n number of individuals genotyped Ath_0006568 2 2 0.478 0.791 2 2 0.356 0.464 Ath_0007271 2 2 0.079 0 5 3 0.619 0.357* Ath_0007753a 2 2 0.218 0* 7 5 0.663 0* Ath_0010749 1 1 0 0 2 2 0.5 0.142* * Departure from Hardy– Weinberg equilibrium (P \ 0.05) Ath_0012547 1 1 0 0 3 3 0.621 0.428* Ath_0107243 2 2 0.079 0 6 5 0.689 0.357* Ath_0110469 2 2 0.079 0 4 3 0.578 0.196* Average 1.6 1.5 0.149 0.111 5 3 0.513 0.273 a A locus located in mitochondria genome directional introgression may be occurring in between putative parental species and A. laxifolia. Acknowledgments The authors thank Samuel Martins and Stuart MacDonald for assistance in the field, Madoka Hirano for help with processing samples and the Department of Primary Industries, Parks, 123 Water and Environment, Tasmanian Government, for providing collection permits. Funding was provided by the Australian Research Council (DP120100501), a Japan Society for the Promotion of Science Grant-in-Aid for Scientific Research (JSPS KAKENHI 26850098), and the Environment Research and Technology Development Fund of the Ministry of the Environment (4-1403). Conservation Genet Resour Appendix Information of the plant samples used for the initial PCR amplification trials Species Locality GPS coordinates Voucher no. A. cupressoides D. Don Mt. Kate, Tasmania 41°380 10.000 S, 145°570 02.800 E KYO 00019887 A. cupressoides D. Don Lake Dobson, Tasmania 42°410 05.500 S, 146°350 34.600 E KYO 00019888 A. cupressoides D. Don Ouse River, Tasmania 41°530 49.000 S, 146°360 59.700 E KYO 00019889 A. laxifolia Hook. Tarn Shelf, Tasmania 42°400 07.500 S, 146°330 37.000 E KYO 00019890 0 00 0 00 A. laxifolia Hook. Tarn Shelf, Tasmania 42°39 27.8 S, 146°34 02.8 E KYO 00019891 A. selaginoides D.Don Mt. Black, Tasmania 41°470 04.600 S, 145°350 37.400 E KYO 00019884 A. selaginoides D. Don Collingwood River, Tasmania 42°070 27.000 S, 145°490 56.500 E KYO 00019885 A. selaginoides D. Don Tarn Shelf, Tasmania 42°400 40.000 S, 146°340 11.000 E KYO 00019886 References Faircloth BC (2008) MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour 8:92–94 Goudet J (1995) FSTAT (version 1.2): a computer program to calculate F-statistics. J Hered 86:485–486 Hill KD (1998) ‘Gymnosperms’—the paraphyletic stem of seed plants. Flora of Australia. CSIRO, Melbourne, pp 505–526 Jordan GJ, Brodribb TJ, Loney PE (2004) Water loss physiology and the evolution within the Tasmanian conifer genus Athrotaxis (Cupressaceae). Aust J Bot 52:765–771 Neale DB, Marshall KA, Sederoff RR (1989) Chloroplast and mitochondrial DNA are paternally inherited in Sequoia sempervirens D. Don Endl. Proc Natl Acad Sci USA 86: 9347–9349 123